Table I. Genes and associated primers used for qRT-PCR studies
Gene NameAccession (Phytozome)Forward Primer (5′→3′)Reverse Primer (5′→3′)Reference
GmATP synthaseGlyma20g25920GCGATTCTTAAGCCAGCCTTTACACACCCTGGAAACTGGTGAHayashi et al. (2012)
GmCons6Glyma12g05510AGATAGGGAAATGGTGCAGGCTAATGGCAATTGCAGCTCTCLibault et al. (2008)
GmENOD40bGlyma02g04180GAGTGGCGGAAGCAGATACACCTACATAGCCATAGAGACCCCAATGKouchi and Hata (1993)
GmNIN-2bGlyma14g00470ACAGGGATGCTGGGTGGAACGCAGCCTCTAGTCTTTCTTTGAHayashi et al. (2012)
GmRabA2Glyma14g07040CAACCAGAACATTGCAGGTGAAGGCTCCAACAGCTCCTCTBlanco et al. (2009)
GmTIR-NBS-LRRGlyma12g03040GAGTCATTTAGAAGGTTCGAAGGAAATCGCGTGAATATCTTCGTCTGATAHayashi et al. (2012)
GmCytochrome P450Glyma11g37110TCACCCAGAAACCGCAAGAGATCCAATGGCACGCTCAAACHayashi et al. (2012)
GmRIC1Glyma13g36830CAAATGCAACAATGGCTACTCGGCCATGGAGATTACTAGCCTGCReid et al. (2011a)
GmRIC2Glyma06g43680GGCCACAATCCATTATTCGCTACGCACACGCTTTGATAGGTGReid et al. (2011a)
GmNIC1Glyma12g33660GCCAAAGGTTGTTCACGAGAAGCAAAACTTGCCTTCAGGAGCReid et al. (2011a)