Table I. PCR-based markers used to genotype identified mutants, reference lines, and transgenes
Mutant or TransgenePrimer Name (5′ to 3′ Sequence)EnzymeAmplicon Size
Wild TypeMutant
bp
pex1-2PEX1-RsaI-F (ACTCAATTAACAGTAGACCAGATGTA)aRsaI151, 27178
PEX1-RsaI-R (TGAGGACAAAAATGATTAGCAGAA)
pex1-3R405-p1-3 (AGCTCCATGCATACTCTTTTTC)BccI183, 157340
R405-p1-4 (TATTATTAACTATCAACTCAG)
pex6-1F10O3-7 (CAGACTTTACTGGCAAAAGCTGTGGCG)XhoI270, 115385
F10O3-T (GCTTGCACCTATAATAAACAGATCCTGGG)
35S:PEX1 and 35S:HA-PEX1PEX1-F1 (CATTCGTTGCTTCTGTCCA)206206, 107
PEX1-E2 (GCCCCACGTTCCGAGGTAG)
35S:PEX5PEX5-38 (TGAAGACCAACAGATAAGG)264264, 168
PEX5-39 (CCCATTGGAGGCATAGG)
35S:HA-PEX6PEX6-3F1-BstNI (AACAGACCTGACTTGATTGAT)252252, 176
PEX6-3R1 (GAGGGACACTTCTTTGCTAC)
  • a The underlined base indicates a difference from the original sequence to insert an RsaI site in the wild-type amplicon.