Table II. PCR-based markers used for recombination mapping of pex1-3
MarkerNearest GenePrimer Name (5′ to 3′ Sequence)Amplicon Size
Col-0Ler
bp
CIW18At5g05170CIW18-1 (AACACAACATGGTTTCAGT)135129
CIW18-2 (GCCGTTTGTCTCTTCAC)
F7K24At5g19270F7K24-1 (TGCAAAATTCTAGCTATCG)125141
F7K24-2 (ACTTTTGTATGGCTAATGAG)
MWD9At5g22420MWD9-1 (TAGGGTCGTGGTTGGTTG)133118
MWD9-2 (CTGGCCTCTCTATCTGATAC)
GA3At5g25900GA3-1 (CGGAGGCTATCATGTCCCTGC)156144
GA3-2 (CCCAACGCTTCTTATCCATGTTGC)