Table II. List of oligonucleotides used in this study
NameSequenceUse to Amplify
oHG149TCGCAACGAGGAAACGAGACLeft flank of mig1 locus
oHG183CAACCTCGAGCGGCCTACCCAATCTTCAACGLeft flank of mig1 locus
oHG151ATCTAGGCCTGAGTGGCCCTGACGGTAACGGCCGAAACRight flank of mig1 locus
oHG152CGCTTTTGCCACTGCTTCCRight flank of mig1 locus
oHG153CCGTGGTATCTGAAGCAATCComplementation and localization constructs
oHG154CCGCCTTGTTGTTCATGGComplementation and localization constructs
oHG194TGCGCCGCTCAGCATGACATACIntegrated constructs at mig1 locus
oHG195ACGTCGCTGACTGGAGGCTTTGIntegrated constructs at mig1 locus
oHG202ATCACGGCCTCTAAGGCCAATACGCAAACCGCCTCTCegfp-nos terminator
oHG205GATCACGGAGTGGCAGGTGCAGTGAGCAAGGGCGAGGAGegfp-nos terminator
oHG186GTGGAGGAGCCCTACATACCsr10073 in qRT-PCR
oHG187CAGCGGGCTTATCAATGTGGsr10073 in qRT-PCR
oHG188ATGCGCCTTCTACTCCAACGsr10075 in qRT-PCR
oHG189CCGCTCTTTGCAACTCTTCG)sr10075 in qRT-PCR
oHG190CATGAGAATGCCATGCTTCCsr10077 in qRT-PCR
oHG191TTCATGGTGCATCACGATCCsr10077 in qRT-PCR
oHG192ATTGGAGCCCATGCCTCACCsr10079 in qRT-PCR
oHG193TGGCGTACACGGCGTATTCGsr10079 in qRT-PCR
oHG143CCGCCAGAATCATGTCCAACppi in qRT-PCR
oHG144CATGAACTGCGGGATGACACppi in qRT-PCR
oBH73CCGCCAGAATCATGTCCAACACT1 in qRT-PCR
oBH74CATGAACTGCGGGATGACACACT1 in qRT-PCR
oHG252ACTTCATCTCCACCAACAACCCPIN1 in qRT-PCR
oHG253AGAAGTCGCCGTACATGCCCPIN1 in qRT-PCR
oHG264AGCCACCACTCATCGTTGTCTB1 in qRT-PCR
oHG265CGTATCCTCCGTTGCCAAAGTB1 in qRT-PCR
oHG210ATCTAGAATTCAGTGGCTCTCAGAGCGGCGGSAD1ΔSP for yeast two hybrid
oHG211ATCTAGGATCCCTATACTGATAAATGGAGAGCAGGSAD1ΔSP for yeast two hybrid
forAAGCGGCCGCTAGTGGCTCTCAGAGCGGSAD1∆SP for Arabidopsis expression
revATGAATTCCTATACTGATAAATGGAGAGSAD1∆SP for Arabidopsis expression