Table I. Pup1 candidate genes and RT-PCR primers
Gene NameAnnotationTIGR6 BLASTpE ValueRT-PCR Primers (5′–3′)aGene Expressed
OsPupK01-1Hypothetical proteinNo significant similarity; located in intergenic region between LOC_Os12g26260 and LOC_Os12g262704.10E-07F: ACACGTACAATGTCACCGGG R: ATGTCAACGCCACGTTCACGNo
OsPupK04-1Highly similar to α-DOX2 (LOC_Os12g26290)α-DOX2, putative, expressed0F: GGGATATCAAGCTTGTGGTGR: GAATGCTGTTTCGCTTATGGYes
OsPupK05-1Located within OsPupK04, expressedTransposon protein, putative, CACTA, En/Spm subclass0.97F: AGTACAGTCCGGCGTCATACR: CCGAGATCTGGTCCTCAATAYes
OsPupK20-2Highly similar to dirigent protein, putative, expressed (LOC_Os12g26380)Dirigent, putative, expressed3.50E-100F: CTGGACTTGACCCCAATGTAR: TCTGATGGAGTGTTCGGAGTYes
OsPupK29-1Similar to expressed proteins LOC_Os12g26390 and LOC_Os12g26410LOC_Os12g26390, expressed, LOC_Os12g26410, expressed0 6.2E-101F: CCAATGCATCCAATTCTTGTR: ATGAGCCCAGATTACGAATGYes
OsPupK46-2Most similar to protein kinase genes (LOC_Os01g49580, LOC_Os01g49614, LOC_Os08g24630)LOC_Os01g49580, expressed, LOC_Os01g49614, expressed, LOC_Os08g24630, expressed1E-93 1.3E-91 1.1E-87F: AGGAAGATGGTTGTCGTTGGR: TTCACACCAAACAGTGTTGTCYes
OsPupK53-1Insignificant similarity to zinc finger CCCH-type family protein, expressed (LOC_Os05g10670)Zinc finger CCCH-type family protein, putative, expressed6.40E-37F: TTCAGCTTCTTCGCCGACACR: TAGACGAGCACGTCGTTGACNo
OsPupK67-1Highly similar to aspartic proteinase precursor nepethesin-1 precursor (LOC_Os12g262470)Aspartic proteinase nepenthesin-1 precursor, putative, expressed9.50E-211F: CACGAGCTATTTCGTGTGGGR: GGTACGAGAACTTGCCGAACNo
  • a F, Forward primer; R, reverse primer.