Table II. Primer sequences of gene-specific Pup1 markers
Marker NamePup1 Gene ModelMarker TypePhysical LocationAmplicon Size K/NPrimer Sequence (5′−3′)a
Kasalath AB458444.1Nipponbare Chromosome 12
bpbp
K1OsPupK01-1Codominant96,175−96,29915,315,156−15,315,277125/122F: AGTCTGGATGGACAACTCTGCCTG
R: TGCTAGCTCATTGCCGTTACGTCG
K5OsPupK05-1Codominant116,430−116,70115,336,063−15,336,342272/280F: ATTCAGACATCGACGGCGAC
R: TCCTCGTAAACATGGCTTGC
K20-1OsPupK20-2Codominant169,881−170,12015,410,254−15,410,496240/243F: TCAGGTGATGGGAATCATTG
R: TGTTCCAACCAAACAACCTG
K20-1MseOsPupK20-2CAPS (Mse1)201/243
K20-2OsPupK20-2Codominant169,290−170,60715,409,652−15,410,981982/995F: TCAAAAATTTCTTCAGGTATGTACTCC
R: TTGGGTGATCAGCTTTCAGA
K20-2BspOsPupK20-2CAPS (Bsp1286I)K, 231 + 349 + 402;
N, 413 + 582
K29-1OsPupK29-1Codominant205,067−205,28715,431,572−15,431,786212/206F: ATGGCCAACGGGGTAGAG
R: GTCCAGGTAACCACGAGGAA
K29-2OsPupK29-1Codominant204,398−204,61615,430,672−15,430,883291/212F: CCCGTCTGCGTTCTACCTTA
R: CTCCCGTCAAGCACAAATCT
K29-3OsPupK29-1Codominant202,698−202,93315,419,578−15,419,825236/248F: TTCGTCCAGATGCTGCTATG
R: TCTTCGGTGTAATTGGCACA
K41OsPupK41-1Dominant262,050−262,431Absent382/−F: TGATGAATCCATAGGACAGCGT
R: TCAGGTGGTGCTTCGTTGGTA
K42OsPupK42-1Dominant267,154−268,071Absent918/−F: CCCGAGAGTTCATCAGAAGGA
R: AGTGAGTGGCGTTTGCGAT
K43OsPupK43-1Dominant268,590−269,501Absent912/−F: AGGAGGATGAGCCTGAAGAGA
R: TCGCACTAACAGCAGCAGATT
K45OsPupK45-1Dominant274,072−274,344Absent276/−F: GCGGAAGAAGAGGATAACGA
R: TCTAGGCTTCGTTTGGCAAG
K46-1OsPupK46-2Dominant275,710−276,232Absent523/−F: TGAGATAGCCGTCAAGATGCT
R: AAGGACCACCATTCCATAGC
K46-2OsPupK46-2Dominant276,371−276,597Absent227/−F: AGGAAGATGGTTGTCGTTGG
R: TTCACACCAAACAGTGTTGTC
K48OsPupK48-1Dominant282,795−283,640Absent847/−F: CAGCATTCAGCAAGACAACAG
R: ATCCGTGTGGAGCAACTCATC
K52OsPupK52-1Dominant300,870−301,374Absent505/−F: ACCGTTCCCAACAGATTCCAT
R: CCCGTAATAGCAACAACCCAA
K59OsPupK59-1Dominant324,843−325,392Absent550/−F: GGACACGGATTCAAGGAGGA
R: TGCTTTCCATTTGCGGCTC
  • a F, Forward primer; R, reverse primer.