Table I.

Codon frequency in wild-type and mutant rbcL and atpB segments

rbcL wild type
 CodonAUG1-a UCACCACAAACAGAGACUAAAGCAAGUGUUGGAUUCAAA
 Amino acidMetSerProGlnThrGluThrLysAlaSerValGlyPheLys
 Fraction1.000.210.240.570.230.380.370.600.290.140.350.240.400.60
 Triplet/1,00024.613.510.621.011.712.418.422.018.19.324.917.922.522.0
rbcL mutant
 CodonAUG1-a aguCCuCAgACAGAaACaAAAGCcucaGUaGGAUUCAAA
 Amino acidMetSerProGlnThrGluThrLysAlaSerValGlyPheLys
 Fraction1.000.140.300.430.230.620.230.600.160.210.310.240.400.60
 Triplet/1,00024.69.313.515.511.720.711.722.010.113.521.817.922.522.0
atpB wild type
 CodonAUG1-a AGAAUCAAUCCUACUACUUCUGGUUCUGGGGUUUCCACG
 Amino acidMetArgIleAsnProThrThrSerGlySerGlyValSerThr
 Fraction1.000.220.270.610.300.370.370.310.380.310.260.350.140.15
 Triplet/1,00024.67.815.518.113.518.418.420.228.220.219.224.99.17.5
atpB mutant
 CodonAUG1-a AGAAUaAAcCCgACaACaagUGGaagUGGGGUgUCCACG
 Amino acidMetArgIleAsnProThrThrSerGlySerGlyValSerThr
 Fraction1.000.220.290.390.300.230.230.140.240.140.260.210.140.15
 Triplet/1,00024.67.816.611.413.211.711.79.317.99.319.215.39.17.5
  • F1-a  AUG, Translation initiation codon.