Table I.

Primer pairs used to amplify the extracellular domain of Lrk genes by PCR

Specific Primer Sequence (5′ to 3′)TaLrk GeneChromosomal Location
G3 GAAAGATGAGTAAATTACTTG55°C Lrk 1A/1B/1D
UP1CTTGCAGTCCAACGGAAG
14F1 ATGTCGCGAATCATGGAC51°C CSLrk17 1D
14R3 GTTTGTAGTCTTCGTACA
G3/19R1 GTCCATTCGAAAAATTG49°C CSLrk6 1B
G3/25R1 GAATTCCATAGGTAAAG49°C CSLrk9 1B
G3/CS3 TGAGAATTGCCGATCACG53°C CSLrk3 1D
G3/CS16 GGGCCAGCAATGCTTTC55°C CSLrk16 1B
G3/CS11 GGGTTGCAGATGAACCCTC55°C CSLrk11 1B
G3/CS13 CAGAACTCCAAAGAAATATC50°C CSLrk13 1A
G3/CS5 GGTTGAAGATGAACTATC48°C CSLrk5 1A
G3/CS41 GAGTGCACTAGGGTTGCAGATGA50°C CSLrk41 ?
UP1/CS22 CCTCCTGCTGCTACCTCTTAC55°C CSLrk22 1D

G3 and UP1 are located in very conserved regions of the Lrkgenes and allow the amplification of all Lrk genes on chromosome group 1 in wheat. They can be used in combination with specific primers to amplify specifically one member of the gene family (CSLrk) and to determine the localization on the homoeologous chromosomes 1A, 1B, and 1D with aneuploid wheat lines. The annealing temperature (Ta) is indicated.