Table III.

Primers and polymorphisms used for STS mapping

STSPrimers (5′ to 3′)3-aAssay3-b
ABG74CTGCAGGAGCCTCCTGACCTGCTGC XhoI
GTATGATGCTCAAGCCCCCGGAATG
ABG452GCCGGCCATTGTTGCAGCTTCC DdeI
CCTTCTTCTCCTGTTGATTGCCAAGTT
ABG452GGGAGTATGTGATATTGTGGGCATCCAG(A/G)CAC3-c
GCATGGAGTGTGCAAGTACGTGGTC
ABG494TGCCAGGTCTTGGTGGGACGAGGAGCTT(A/G)TTT3-dand
CAATGGTGAGACTACCATACCTTACTGTCTTCATT(A)7/8TCC3-d
ABG500CCTTCCACTCTCGACCTCGCCCGTCC BglI
GAGACCACACACTGCAGCATAAGCCAG
BCD386GTGAGCAGTGCAACATGTATAGAG AflIII
CTGGAGAATGCGGAGGTATCATCAG
BPM101CAGCAACGCACGGGGTATCATCTAG PstI
GCTGCCTCAAGAAGTACACCCTGTACC
BPM101GAAATGCATTTCCCTGCGATCAGGATCAATG XbaI
GCTGACATTTGCTCCGTACCTCATCC
CDO98AATGAGTTGTTTAAGCACACGAGAAGAG RsaI
CTTGTGCTTATGTTGTCTACAACGTATG
CDO1173TGCACTGAAGCTCTGAATCTGGATG EcoRV
GGATCACTTGGTGCATGAGAAGTGG
CDO1188GGCCACAAAACCGCGGAAAGAGATAG Bsp143I
AGATCTACCTGTTGCCTAGTTTCTC
DGE18CCTGCTGCTGCTGGAGAACCAGATC HaeIII
GTCTGCTCGAACGCGATCAGGTTCC
COMTACAAGCTGGATTTACCGGTGGCATC NcoI
GCGTGTGAGATCACGGTAAGCAAGG
cMWG758TCTTGTCGCCAGCGATGTCTGTCTG SacII
TCGCCGTTCTCCTCTACCTCTAGTG
MWG800GCTCTAGCCAACTTAGCTGCACATGGAG AluI
GATAGGTTCCACAAAGCACCAGCAGC
MWG913GAGCAGAGCACCCTTGAAGCAGAC Bsp143I
GCTTCATGGATGATCTCTCCAGCA
MWG2056TCATCATGCATTATATGTTCAGGAGATG RsaI
ATGTCGTTTTGGACTTTGCCAATG
MWG2056CAAGCAAGCTGTTTTTTCTTTTCTTACGTAC SstI
GCACAGGCATTGGTTTTATGTGAG

For linkage analysis of STS loci, primer pairs were used to PCR amplify STS sequences from Ror1 segregants and to segregate sequence polymorphisms within the fragments scored by restriction digestion (CAPS analysis) or by direct sequence of the PCR products.

    • F3-a  Forward and reverse primers are shown first and second, respectively.

    • F3-b  Polymorphisms were assayed by CAPS analysis with the restriction enzymes indicated or by assaying the indicated sequence polymorphisms by direct sequencing of PCR products.

    • F3-c  Sequencing performed using forward primer.

    • F3-d  Sequencing performed using reverse primer.