Table III.

Primer sets for gene-specific probe synthesis

NamePrimer SequencesProbe Length
bp
Exp15′CTACTACTACTCCATCGACG3′259
5′AATAAGTTGCACGACACC3′
Exp25′CGACGCAGTGGCACTAGT3′300
5′CGAAGGAGCCATCACCAT3′
Exp35′CGCAGCAGTTCTCTTAGT3′182
5′GCACAAGTCAAAGCATATAT3′
Exp45′GGGATGGGATGCGATGGG3′315
5′GCTAGGGACCGAAGAGAC3′
Exp55′AGGATGAACAGCTAGCGC3′305
5′TAGTACTAGGAGCTGGATCG3′
ExpB15′CCCTTCGATTCATCCGG3′196
5′CCTCCAAAAATGGCATGT3′
ExpB25′AGCTAGCTGGTTTGCGCC3′296
5′AAGCAACAGTGGGCGGG3′
ExpB35′CAGTTCGAGTAGCAGTATATG3′144
5′CGTACATATATATCATCGATCC3′
ExpB45′CCTGAAAAGAGAAATACCG3′213
5′GTATCAAATTACCGGCATG3′
ExpB55′TCCATCATTCAGTACTAGCTC′118
5′CTAGTTAAGGCACCGTAATCC3′
ExpB65′TAATGATCGAGCTAGCT3′216
5′TTAGTATGAAATTATATAACC3′
ExpB75′GGCCGGATAATAATATACA3′240
5′ATCTTAATCGCACTGGTAC3′
ExpB85′GGATCCGTGCCCTGCCCG3′412
5′AGCAACAGTGGGCGGGAG3′