Table I.

Primer sets used for the PCR amplifications of gene-specific probes of β-expansins of rice

Gene NamePrimer NamePrimer Sequence 5′ to 3′TemplateProduct SizeAccession No.
cDNAGenomic DNA
bp
Os-EXPB1 hk368GTCCAGGCCAAGTGAGCATTTTART product of mRNA251 AF261270 AY039023
hk369GGGAGAGCAGACGCCATTAT
Os-EXPB2 hk357CTACGGCTCCAAAGTCCAGTRT product of mRNA150 U95968 AC037426
hk358CACACAGAATCGTAGTACAGTA
Os-EXPB3 hk361CCCTCGGGTATTGTATGGAS11041-a 223 AF261271 AC037426
hk362TAATTTATGACCTTTGTTCTG
Os-EXPB4 hk353TACCGCTCCTTCGTCCAGT C51142 1-a 249 AF261272 AC069300
hk354TTTTCTTTGCCTACCTCCTCCATT
Os-EXPB5 hk359GCAGAAGCTCGCCTCGTCR28721-a 198 AF261273 AY039024
hk360GCAAATCGCAACGCAGAAT
Os-EXPB6 hk363ATTTGCGTGGGATTGAG C51730 1-a 194 AF261274 AC037426
hk364CTGTAGCCTTAAGATTTGGTT
Os-EXPB7 hk372AGCTAATTACTACTACTCCACTCC E31457 1-a 177 AF261275 NA1-b
hk373TCCGACCATTGATTGATTC
Os-EXPB8 hk365CGTCATCCCCCTCAACTS35051-a 176 AF261276 NA
hk328TTTTTTTTTTTTTTTTTTTTTTTA
Os-EXPB9 hk370TCATCCCGGTCAACTGGE21361-a 246 AF261277 AC020666
hk371ATTCATAGTGTTCTTCAGCATCTT
Os-EXPB10 hk440GGAAGGCCAACGCTCTCE13471-a 272 AF261278 AF391111
hk441CACGTTGACAATCCCTTAGAAT
Os-EXPB11
 Set 1hk521CCGCTCCCTGGTGAACTACTCCTARice genomic DNA AY046927 AF391103
hk524CCAAACACAGCCTAAAAGCGAGAA
 Set 2hk522CTCCCTGGTGAACTACTCCTAAATProduct of first PCR483
hk523AGCGAGAATTGAACTTGAGACAG
Os-EXPB12
 Set 1hk525TGGCTTGTGTCACCTTCTACTGRice genomic DNA AY046928 AF391104 (5′ region)
hk528CATCATTTGTTTTAGGACCAGAGT
 Set 2hk526TGCTGCTGTTGTTAATGTTGTTCGProduct of first PCR317 AF391105 (3′ region)
hk527ATCAACAACGCATCTTCAAACTTA
Os-EXPB13
 Set 1hk533CGTCCAAGCCAAGTGAGCATTTTARice genomic DNANA AF391106
hk536CGGATGGGGGCTAGTTTTTGAAGT
 Set 2hk534AGTGAGCATTTTAAGCAAGGAAGAProduct of first PCR570
hk535TGTTATTCACGCCACCTCTTGTA
Os-EXPB14
 Set 1hk529CAGGAGGGAGGATTGATGAGATGRice genomic DNANA AF391107
hk532TGGCCGTCATGATTTCCTTC
 Set 2hk530ATGTAGGGGATATGTAGGGTGGTGProduct of first PCR495
hk531AAAAACCGTTACCTAAATCACTCG
  • F1-a  EST clone nos.

  • F1-b  NA, Not available.