Table II.

ARP Gene Sequence Primers for PCR2-a

ARP2-NcStagtgaaccATGGACAACAAAAACGTCGTCGTTTGC
ARP2-BgNgtctagagatctTTAAGCTTGGCTCATTTTATTC
ARP2-333SCACATGGTATACCTCGGAGGTGCT
ARP2-3′N1GAATTAAATCATCCTGACGGTAGTA
ARP2-3′N2ACCAATTGTACTCAAACTTTGA
ARP3-NcStagtgacccATGGATCCGACTTCTCGACCCGCTATT
ARP3-BgNgtctagagatctTCAATACATTCCCTTGAACACCGGA
ARP3-376SGTCGTGAGCCATCCTGTCCAGAGGT
ARP3-3′N1CTAGCTTACACTGTGTGTACTCA
ARP4-NcStagtgagccATGGGATACGGCGGAGATGAAGTGTCAGCT
ARP4-BgNgtctagagatctTTAAGGGCATTTTCTCTGAATGTA
ARP4-415STCACTAGGCTCATTTCAACAGATG
ARP4-3′N1AGGTTCAGGCGGAATACTAATAATCT
ARP5-NcStagtgagccATGGGATACGGTGGAGACGAAGTGTCA
ARP5-BmNgtctagggatccTCAGCATCGATAAAAGGTAGAGAAAC
ARP5B-138STCTCTACCTTTTATCGATGCTGA
ARP5-3′N1ATCCTAAACCCTCTGACTGTCTCCA
ARP5-3′N2AAGTGTTTAATATTTGCCTAAATA
ARP6-NcStagtgatccATGGGATCAAACATCGTTGTTCTAGACAAC
ARP6-BmNgtctagggatccTCAATGAAAGAATCGTCTACGACA
ARP6-362SGAGCTTCGACCACTTGTCCCAGAT
ARP6-N1GCATTACAATATACGACAAATAATGTG
ARP7-NcStagtgaaccATGGAAGCACTAGTTGTTGATGCTGGC
ARP7-BmNgtctagggatccTCAGAAACATTTCCTGTGAACCA
ARP7-281SGTACTTTGTGGTGGTACAACCTCCATG
ARP7-3′N1TACATAATCTGGTCCACATCTTCA
ARP8-NcStagtgaaccATGGGAATCCTGAAGAAAGTATGGGGATCG
ARP8-BmNgtctagggatccTCACCACATGAGTCTTGACTTG
ARP8-361SCACTGTGATGCAGCAGGACTTACA
ARP8-N1TGTACCTTATAACAGCTGTAACCTGCC
ARP8-N2ATCACCAAGAGTTTCAACAATCTCTCG
ARP9-NcStagtgatccATGGCAAAACCAAAATCCAATTCTCAT
ARP9-BmNgtctagggatccCTAGGGGTTGATGAAGTACATTG
  • F2-a  Primer sequences are in capitals and lower case characters indicate added cloning sites and sequence clamps.