Table III.

Primers used in the RT-PCR analyses

TranscriptAccession No.Nucleotide Sequence (from 5′ to 3′)
CYP85A1 AB009048 GGACGTGAAGTCAATGAAGTTCACT
TTCCTTACCAGGACAAAGCCTTGTC
CYP85A2 AP002060 CGAACCGCTCACTCTCGACGAT
AATAGCTCTTTGATTCTAAGCTCT
CPD/CYP90A1 X87367 GAATGGAGTGATTACAAGTC
GTGAACACATTAGAAGGGCCTG
DWF4/CYP90B1 AL132979 GAAGGAACTAGGAGAGTCAG
CCACGTCGAAAAACTACCACTTC
ROT3/CYP90C1 Z99708 GGAGATGAAGAGGCGTAAATTGGA
GCAAATACTGCTGTTTGCCGATCC
CYP90D1 AP001307 GTCAAATTCCTCTCTGATTCTCCTG
TCGAGACCAGGGCACAATCTCTGAC
DIM1 AB025631 CTCGAATGGGTCCACCGCGAAATG
CATACAATTCACCATTAAACATTC
DET2 AC007661 AATCTCCTCAATGGTTATATC
CGTGTACAGAAAAAATCCAATACC
UBQ10 AL161503 GGACCAGCAGCGTCTCATCTTCGCT
CTTATTCATCAGGGATTATACAAG