Table V.

Primers and TaqMan probes used for RT-PCR

Gene NameForward Primer SequenceReverse Primer SequenceTaqMan Probe Sequence
CPDCCCAAACCACTTCAAAGATGCTGGGCCTGTCGTTACCGAGTTTCTGCCATCTCCAAGGGTTGAAAGTGC
DWF4GTGATCTCAGCCGTACATTTGGACACGTCGAAAAACTACCACTTCCTCAGCAAAACAACGGAGCGTCATCG
ROT3ATTGGCGCGTTCCTCAGATCAAGACGCCAAAGTGAGAACAACTCACCTCAAAGACCGGATCACTCGAGA
BR6oxTGGCCAATCTTTGGCGAATCCCGTATCGGAGTCTTTGGTACCGAGTTTCTCAAACAAGGCCCCAAC
CYP90DCTCATTACCCTTGCCGTCAAACAGCTTCATGTTTTCTTCCGTTAGCCTCTCTGATTCTCCTGCTGCCCTCAAT
BAS1TTGGCTTCATACCGTTTGGCTTACAGCGAGTGTCAATTTGGCCGGAGTTCGTACATGCATTGGTCAGAATC
Lhcb1.3GGAGCTCAAGAACGGAAGATTGGGTTCTCTATCGGTCCCTTACCATGGATTCTTCGTTCAAGCCATCGTCA
rbcS1AGCTCTCTTCCGCTACTATGGTTGAAGGCAGCGGAGGACTTAAGTTCAGGCCACTATGGTCGCTCCTTTCA
TCH4CAAGAACATGGAGTCTCTAGGCACTGTGAAAGGAGCTTTAGACCAATCGACTCGAGTCTTTGGAACGCTGATGATTGG
PIF3TCAGGCTCACCAAAGCTAAGCCACACCAGCTCCACAACTTCAAATCTGCTCAAGACAGGAACCCTTCTCCAC
GH3 homolog (BRU6)CGTATATCCAACGGCGATTGTCCAGCAGATGTTCCTGAGCTTTCTTCTCACCCCATCACCGAGTTTCTCA
SAUR-AC1GAGGATTCATGGCGGTCTATGGTTAAGCCGCCCATTGGATTGGTGCCGGTTTCATACTTAAACCAGCCT
IAA3AGCCTAAACCTTTGGCTTCTGAGGTGATTGGATGCTCATTGGTCTTGCACGTACATATGAACATCTCCCATGG
XTR7TCGACGAGTTTGACCTCACTTGGTCCAGCGACAAAGACAGCATAACCACAGAGGCAAAATCTTCAACGGAGG
AtExp8CAACCATCACCGTCACAGCTATGAAGAGGAGGATTGCACCAAAAACTTTTGCCCACCTAACCCTGGCCT
KCS1GCTCAAATACGTGAAGCTTGGACAGCACGGTTCCGGTTAAACAACTCTTGCAACGTGACCACCATTCTCT
18S ribosomal RNACGGCTACCACATCCAAGGAAGCTGGAATTACCGCGGCTTGCTGGCACCAGACTTGCCCTC