Table III.

Primers and TaqMan probes used for RT-PCR

Gene NameForward Primer SequenceReverse Primer SequenceTaqMan Probe Sequence
BR6ox1TGGCCAATCTTTGGCGAATCCCGTATCGGAGTCTTTGGTACCGAGTTTCTCAAACAAGGCCCCAAC
BR6ox2CAATAGTCTCAATGGACGCAGAGTAACCGCAGCTATGTTGCATGACTTGTTGCCGGTTACCCGCAATCTATG
CPDCCCAAACCACTTCAAAGATGCTGGGCCTGTCGTTACCGAGTTTCTGCCATCTCCAAGGGTTGAAAGTGC
DWF4GTGATCTCAGCCGTACATTTGGACACGTCGAAAAACTACCACTTCCTCAGCAAAACAACGGAGCGTCATCG
ROT3ATTGGCGCGTTCCTCAGATCAAGACGCCAAAGTGAGAACAACTCACCTCAAAGACCGGATCACTCGAGA
CYP90DCTCATTACCCTTGCCGTCAAACAGCTTCATGTTTTCTTCCGTTAGCCTCTCTGATTCTCCTGCTGCCCTCAAT
BAS1TTGGCTTCATACCGTTTGGCTTACAGCGAGTGTCAATTTGGCCGGAGTTCGTACATGCATTGGTCAGAATC
BRI1GGTGAAACAGCACGCAAAACTCACGCAACCGCAACTTTTAAACCCCGAGCTTATGAAGGAAGATCCAGC
18S ribosomal  RNACGGCTACCACATCCAAGGAAGCTGGAATTACCGCGGCTTGCTGGCACCAGACTTGCCCTC