Table III.

Genes selected for quantitative PCR to confirm Affymetrix GeneChip results

Genes were selected to have contrasting magnitudes (low, L; medium, M; or high, H) and change in gene expression when assayed using Affymetrix GeneChips in response to the withdrawal of P from hydroponcally grown 28-d-old Arabidopsis for 4, 28, and 100 h. The primers used for quantitative PCR are indicated. -, not determined.

Expression Level GeneChip Analysis GeneChip ID AGI ID Forward Primer Reverse Primer Mean-Fold Change on GeneChip Fold Change for Quantitative PCR
P Starved for 4 h P Starved for 28 h P Starved for 100 h P Starved for 4 h P Starved for 28 h P Starved for 100 h
L Down at 4 h 20518_at At1g10060 AATAGAGGGGATGAAAGC ATGAACAGAAGGAGAATGC 0.34 1.23 0.44 1.00 0.78 0.20
H Up at 4 h 17963_at AT4g12470 CCTCTCTTGCTCTTTTCTTTG GGGACTGGCTTTGGTTTAG 14.15 1.43 0.96 0.14 1.78 0.01
H Up at 4 + 28 h 17014_s_at At2g02990 CTTGCCTTCTGTCTTCTCTG GGATAACAACACTTCTTCTGTG 31.73 4.77 1.88 3.33 11.41 8.45
M Down at 100 h 14048_at At2g18890 GGATAACAAGAGGAGGAAGAGATG CAACAACCAAGAAGAGACAAGAC 0.58 0.82 0.26 0.97 1.50 0.42
M Up at 100 h 12597_at At2g22780 GCTTCCCTTCTTCGCATC GCCTTCTCTAATCCCATCCTC 1.57 0.72 4.00 1.52 1.79 1.54
H Up at 100 h 14116_at At5g26340 GCCGTTCCGTTGTTCTTG CTTGGCGGTCCCATAGTTG 2.35 1.85 4.31 0.32 4.45 0.77
H Up at 100 h 15629_s_at At1g17740 GAAGGGGAGGTTGAAAGTGG CACCGTATTAGCCGTTGGAG 3.74 2.22 4.47 0.29 4.79 3.23
H Up at 100 h 17104_s_at At4g35630 ACACGCCTCCTTGCTTTG GCTTTCCTCTGGTTCTTCTTCTC 2.01 1.61 2.85 0.60 5.45 3.08
M Up at 100 h 17775_at At1g61800 AAGAAAGGGATGAAAGGGAAG CACGGCAATAGAAAATGGAG 2.74 1.13 3.42 1.11 19.76 5.14
- - Not present 18s rRNA CATAAACGATGCCGACCAG AGCCTTGCGACCATACTCC 1.13 1.25 1.15
- - Not Present IPS1 AGGGGATGGCCTAAATACAAAATG GGGAGATAAACAAAACTCGCAGTC 0.89 14.68 1143.05
- - Not Present SQD1 CACCACCCGAAACATCTACC ACCGCAATAACCATCTCCAC 0.68 2.1 4.5