Table II.

Primers used in making linker-scan constructs

Primera Sequence (5′-3′)b Position (5′-3′)c Construct
LS1-f CCGCCCGGTTGGAAGGAGGTTTGACGCGAG -284 to -259 pCT362LS1
LS2-f CCGCTTGGAAGGAGGTTTGACGCGAGGGAT -280 to -255 pCT362LS2
LS3-f AAACAAGGAGGTTTGACGCGAGGGATTTAG -276 to -251 pCT362LS3
LS4-f CCGCAGGTTTGACGCGAGGGATTTAGGTGC -272 to -247 pCT362LS4
LS5-f AAACTTGACGCGAGGGATTTAGGTGCGAGT -268 to -243 pCT362LS5
LS6-f AAACCGCGAGGGATTTAGGTGCGAGTCCGA -264 to -239 pCT362LS6
LS7-f CCGCAGGGATTTAGGTGCGAGTCCGACTTA -260 to -235 pCT362LS7
LS8-f CCGCATTTAGGTGCGAGTCCGACTTACGAA -256 to -231 pCT362LS8
LS9-f CCGCAGGTGCGAGTCCGACTTACGAAGGTA -252 to -227 pCT362LS9
LS10-f CCGCGCGAGTCCGACTTACGAAGGTACCAT -248 to -223 pCT362LS10
LS11-f AAACGACTTACGAAGGTACCATCGGGCCCC -240 to -215 pCT362LS11
LS12-f CCGCTACGAAGGTACCATCGGGCCCCCCCT -236 to -211 pCT362LS12
LS13-f CCGCAAGGTACCATCGGGCCCCCCCTCGAG -232 to -207 pCT362LS13
LS14-f CCGCTACCATCGGGCCCCCCCTCGAGGTCG -228 to -203 pCT362LS14
LS1-r CCGCTACAACGCTGCCAACGTGGTGGCGCG -293 to -317 pCT362LS1
LS2-r CCGCAATCTACAACGCTGCCAACGTGGTGG -289 to -314 pCT362LS2
LS3-r AAACTGAAAATCTACAACGCTGCCAACGTG -285 to -310 pCT362LS3
LS4-r CCGCCCGGTGAAAATCTACAACGCTGCCAA -281 to -306 pCT362LS4
LS5-r AAACCCAACCGGTGAAAATCTACAACGCTG -277 to -302 pCT362LS5
LS6-r AAACCCTTCCAACCGGTGAAAATCTACAAC -273 to -298 pCT362LS6
LS7-r CCGCACCTCCTTCCAACCGGTGAAAATCTA -269 to -294 pCT362LS7
LS8-r CCGCTCAAACCTCCTTCCAACCGGTGAAAA -265 to -290 pCT362LS8
LS9-r CCGCCGCGTCAAACCTCCTTCCAACCGGTG -261 to -286 pCT362LS9
LS10-r CCGCCCCTCGCGTCAAACCTCCTTCCAACC -257 to -282 pCT362LS10
LS11-r AAACACCTAAATCCCTCGCGTCAAACCTCC -249 to -274 pCT362LS11
LS12-r CCGCTCGCACCTAAATCCCTCGCGTCAAAC -245 to -270 pCT362LS12
LS13-r CCGCGGACTCGCACCTAAATCCCTCGCGTC -241 to -266 pCT362LS13
LS14-r CCGCAGTCGGACTCGCACCTAAATCCCTCG -237 to -262 pCT362LS14
  • a Forward primers (LSn-f) are designed along with Ars coding strand, and reverse primers (LSn-r) are designed along with complementary strand of Ars. b Underlined nucleotides indicate introduced mutations. c Mutated sequences in primers are not included in the numbers of positions.