Table I.

Probes, primers, and their final optimal concentrations used in real-time PCR

Each Taqman probe was labeled with 6-fluorescein at the 5′ end and the quencher TAMRA at the 3′ end.

Enzyme Primers/ Probes Sequence (5′ to 3′) Optimal Concentration
nm
HPT Forward TCTCTAAAAGACTTCTGTTTGCTATTCG 900
Reverse AGTCGAGATTTCGGGTTAATGC 900
Probe AAAGCCTCAGGCTGACCCGCAGT 175
HPPD Forward CAAGGAGTGTGAGGAATTAGGGATT 300
Reverse TCGTCGGCCTGTCACCTAGT 300
Probe ATGATCAAGGGACGTTGCTTCAAATCTTCA 150
HGAD Forward ACCAACCATCGAGGAGGAAA 900
Reverse TAAATACAGTCCTTACAGCACCAACTG 900
Probe ATGACAAAATCAAGCAAGGCCACACCA 175
TC Forward GTATTTGAGCCTCATTGGCAGAT 900
Reverse TCACCGCCCCATTCTATCC 900
Probe ATGGCAGGAGGCCTTTCCACAGG 200
GGPS1 Forward TCCGGTGAGAGTGGTTCGAG 900
Reverse CTTGACCCGCCACTAACCC 900
Probe TTGGAGAATTGGCTAAAGCGATAGGAACAGA 200
GGDR Forward CACTTAGGGAACACCCAACCA 900
Reverse ACTTACTATGAGGATTTAGCTGAGATGTATG 900
Probe AGAAATCCGGCGACACATCATCTCCA 150
TAT Forward AACCGAAAGCCAACGTTTTG 900
Reverse TCTTGTAGATGGAGCGGACTAGGT 600
Probe TTCCGAGTCCCGGCTTCCCATG 200
g-TMT Forward GGCCAAGAGAGCCAATGATC 900
Reverse CGCATCCGCAACTTGGA 900
Probe CGGCTGCTCAATCACTCTCTCATAAGGCT 200
EF-1α Forward CGAACTTCCATAGAGCAATATCGA 300
Reverse GCATGGGTGTTGGACAAACTT 300
Probe ACCACGGTCACGCTCGGCCT 175