Table I.

Tagged Arabidopsis genes with known targeting specificities and sequences of DNA primers used for their amplification

Gene NamePosition on ChromosomePrimer Sequence (5′ => 3′)
AGI CodeStartEndP1P2P3P4
MFP2At3g0686021618752166315GCTCGATCCACCTAGGCTCATTGTTATGAACGGTTGGTCTTTGGCACAGCTCCACCTCCACCTCCAGGCCGGCCGCTCTGTAATACAAATGGAAGTGCTGGTGCTGCTGCGGCCGCTGGGGCCGCTCCCGTGAAACAAGCCCGTAGCGAGACCACAGGAGTTGGTCGTCGACTATCC
Pex5At5g562902280375522809345GCTCGATCCACCTAGGCTTTCGGATCCTAGATCGGGTCTTCACAGCTCCACCTCCACCTCCAGGCCGGCCGAGATTCCTTGACTCACAAGCTTCTATTGCTGGTGCTGCTGCGGCCGCTGGGGCCGATCTCTTGCAGAAAGAATTCCCGCTGTGCGTAGCGAGACCACAGGATCCGTGAGACCCCCTTTTT
delta-TIPAt3g1624055033015507094GCTCGATCCACCTAGGCTCAAGCATCTTCACAGGTTTTGGCACAGCTCCACCTCCACCTCCAGGCCGGCCGAAATCAGCAGAAGCAAGAGGATGCTGGTGCTGCTGCGGCCGCTGGGGCCGTTCCTCTTGCTTCTGCTGATTTCCGTAGCGAGACCACAGGACCATCCATTAATTTGTCATTGTTGT
PIP2AAt3g5342019819151 (-) strand19814307GCTCGATCCACCTAGGCTTTGGTCGGATCTACGATGTTCTCTCCACCTCCACCTCCAGGCCGGCCCGTTCTGAGAGCTTCAGGTTCTAAGTCTTGGTGCTGCTGCGGCCGCTGGGGCCCTTGGATCATTCAGAAGTGCTGCGTAGCGAGACCACAGGACTCGAACTTGGCTGAGGATT
PRP2At2g2114090721159067216GCTCGATCCACCTAGGCTCACCGTCTCCGAGTCTCTTCTCCACCTCCACCTCCAGGCCGGCCTTGTCTGCCCTCCTCTCACTTGGTGCTGCTGCGGCCGCTGGGGCCTGATCTAAAAACATCCCCTTGATCGTAGCGAGACCACAGGAAATGCACATAGATTCTACAGTTCCATAG
Fim1At4g267001346367413467605GCTCGATCCACCTAGGCTCGCCAAATTAAACAGCAACAACACAGCTCCACCTCCACCTCCAGGCCGGCCGATTTCAGAAACCGCATCACCAACTGCTGGTGCTGCTGCGGCCGCTGGGGCCACCACGGTCTCAGAGGAAGCCGTAGCGAGACCACAGGAAAGTCATTTTTGCGCCAGATTA
MAF1At5g430701730987017305500GCTCGATCCACCTAGGCTAACCAAATCGGTTAACATTTTCAATCACAGCTCCACCTCCACCTCCAGGCCGGCCATCAACAGCTGATTCAATTCCATCTGCTGGTGCTGCTGCGGCCGCTGGGGCCTCGAAGATTGATTCAAGTGAAGCTCGTAGCGAGACCACAGGATTCTAGAGTTTAAGAAAGCACTCCCA
VIP2At5g597102407299224079768GCTCGATCCACCTAGGCTGCAATCGTCGGTTCGTCACTCACAGCTCCACCTCCACCTCCAGGCCGGCCGTACTTGATAACAAAATGTTCCTGCGATATGCTGGTGCTGCTGCGGCCGCTGGGGCCGAGCTTATGGAAAAGAGACCAAGCCGTAGCGAGACCACAGGAGGATGAAGAGAGAATGTTCTTCGAG
VIP1At1g437001648505116488971GCTCGATCCACCTAGGCTGCTTGAGCGTTTATTCTGGCCACAGCTCCACCTCCACCTCCAGGCCGGCCCTGCCCGTTTGTACTCATCTGTGCTGGTGCTGCTGCGGCCGCTGGGGCCCCATCGCTCCCAAGCTACATGCGTAGCGAGACCACAGGAGCACCATTTCTCATTTGTTGGTAT
GSR1At5g376001495555814949978GCTCGATCCACCTAGGCTTGAGCATGGTTGTAGTCATTTCGCACAGCTCCACCTCCACCTCCAGGCCGGCCAGCAATCATGGAAGTGACAATGTTGCTGGTGCTGCTGCGGCCGCTGGGGCCGAGACTACAATCCTCTGGAATCCTCGTAGCGAGACCACAGGAGTTACCGGAGAGTGGATTAGCG