Table IV.

New markers used in genotyping the Ler/Sha RIL population

ChromosomeMarker nameBACPrimer 1 (5′ to 3′)Primer 2 (5′ to 3′)Origin
1F3F19F3F19CGTCCAGACACTGACATTGGTTTTAGGCCACTCACGTTCAGTGGGGTTAAACTGenetics
1F6D8-94F6D8GTCATTGGTTGCAATACGAGAGCGCTGCCTCTTCCTTGTAAAGCCIndel
2F3P11-6bF3P11TTCAATCTTCTCTACTGTCTTCGAGCAGGAAGTAGTAAGTGGAATAAlonso Blanco
3F8J2F8J2GTGACCCAAGTGGGATCTCTCACGTGTGGGCAATCTTTTAATGenetics
4FRIF6N23CATGTCGTAATCATGCAACCGAAGATCATCGAATTGGCTony Gendall
4C6L9-78C6L9TGCTTTGTGAAAGTCTCTCATGCCCCCTTTGATTGCTCAGTGATATCGIndel
4M4I22-22M4I22CGCTTTTAGGGGTAATATCGTCACCTGTGTGATCAGGCAAAACCAGTIndel
5FLCT31P16CATTGGATAACTAATCTTTGAGCCAGGCTGGAGAGATGACAAAATony Gendall
5K9D7K9D7GCTGTTGTAATTTGTGATAGGGCATATGCCACGTTTCTTAATAGGenetics
5K8A10K8A10AATGCCAAGGATCAAAAGTGTTGATGATCGGAGGAAAATGAAAAGenetics
  • Genetics: Primers developed by co-workers in genetics department.

  • Indel: Primers developed based on Ler and Col indel as found in the Cereon database (Jander et al., 2002).

  • Alonso Blanco: Primers were a gift from Dr. Alonso Blanco.

  • Tony Gendall: Primers were a gift from Dr. Tony Gendall (Gazzani et al., 2003).