Table III.

Genotype frequencies of InDels among rice chloroplast genomes

InDelsLocus in 93-11SequenceF in 93-11MF in 93-11MF in PA64SMF in Nipponbare-G
%
I-75,016CTTTATC94 (205)6 (205)0 (103)0 (234)
D-16,252T92 (193)8 (193)1 (108)3 (232)
D-698,554GAATCCTATTTTTGTTCTTATACCCATGCAATAGAGAGCGAGTGGGAAAAGGGAGGTTACTTTTTTTCA100 (69)0 (69)0 (118)0 (188)
D-412,610AGGG96 (200)4 (200)5 (137)2 (352)
D-213,946AC95 (228)5 (228)0 (150)3 (314)
I-116,613A98 (215)2 (215)0 (114)0 (230)
D-617,324TAGAAA99 (306)1 (306)0 (134)0 (336)
I-3217,741TAACAAATTCTTAGAGTATTTCTGGTAGAATT97 (261)3 (261)1 (184)2 (375)
I-143,861A98 (206)2 (206)0 (114)0 (177)
D-546,050TATAT93 (209)7 (209)1 (95)11 (232)
D-146,136T100 (129)0 (129)0 (66)0 (140)
D-646,494AGAAAA96 (227)4 (227)0 (128)0 (222)
I-147,166T96 (137)4 (137)6 (50)3 (241)
D-156,998T90 (186)10 (186)0 (86)3 (144)
D-957,009AAAAAAAAG90 (187)10 (187)0 (95)0 (119)
D-257,011TT90 (187)10 (187)0 (95)0 (119)
I-557,591AAAGT96 (227)4 (227)0 (148)0 (236)
I-560,813TGTAT98 (159)2 (159)2 (113)5 (195)
D-265,568TT91 (202)9 (202)0 (125)2 (234)
D-175,933T95 (152)5 (152)3 (89)3 (161)
D-176,184A99 (213)1 (213)5 (116)1 (166)
D-176,524T100 (216)0 (216)4 (129)0 (106)
I-377,677TGG96 (197)4 (197)0 (142)0 (206)
D-178,383T96 (142)4 (142)0 (130)0 (100)
I-280,564TT100 (242)0 (242)0 (196)1 (173)
I-4104,486CAAA99 (287)1 (287)3 (61)2 (400)
D-4134,497AATA100 (130)0 (130)1 (150)0 (158)
  • All the InDels between 93-11 and PA64S/Nipponbare-G are listed according to the nucleotide order in the 93-11 chloroplast sequence. I or D depict insertion or deletion of a major genotype at a given polymorphic site. The numbers following D or I, joined with hyphens, indicate the InDel length in basepairs. At a given intersubspecific InDel site, the major genotype in 93-11 could be the minor genotype in PA64S or Nipponbare-G or vise versa. Frequency (F) and Minor genotype frequency (MF) are percentages of the major and minor genotype at a given polymorphic locus. The number in the parentheses is the total number of the surveyed sequence traces.