Genotype frequencies of InDels among rice chloroplast genomes
InDels | Locus in 93-11 | Sequence | F in 93-11 | MF in 93-11 | MF in PA64S | MF in Nipponbare-G |
---|---|---|---|---|---|---|
% | ||||||
I-7 | 5,016 | CTTTATC | 94 (205) | 6 (205) | 0 (103) | 0 (234) |
D-1 | 6,252 | T | 92 (193) | 8 (193) | 1 (108) | 3 (232) |
D-69 | 8,554 | GAATCCTATTTTTGTTCTTATACCCATGCAATAGAGAGCGAGTGGGAAAAGGGAGGTTACTTTTTTTCA | 100 (69) | 0 (69) | 0 (118) | 0 (188) |
D-4 | 12,610 | AGGG | 96 (200) | 4 (200) | 5 (137) | 2 (352) |
D-2 | 13,946 | AC | 95 (228) | 5 (228) | 0 (150) | 3 (314) |
I-1 | 16,613 | A | 98 (215) | 2 (215) | 0 (114) | 0 (230) |
D-6 | 17,324 | TAGAAA | 99 (306) | 1 (306) | 0 (134) | 0 (336) |
I-32 | 17,741 | TAACAAATTCTTAGAGTATTTCTGGTAGAATT | 97 (261) | 3 (261) | 1 (184) | 2 (375) |
I-1 | 43,861 | A | 98 (206) | 2 (206) | 0 (114) | 0 (177) |
D-5 | 46,050 | TATAT | 93 (209) | 7 (209) | 1 (95) | 11 (232) |
D-1 | 46,136 | T | 100 (129) | 0 (129) | 0 (66) | 0 (140) |
D-6 | 46,494 | AGAAAA | 96 (227) | 4 (227) | 0 (128) | 0 (222) |
I-1 | 47,166 | T | 96 (137) | 4 (137) | 6 (50) | 3 (241) |
D-1 | 56,998 | T | 90 (186) | 10 (186) | 0 (86) | 3 (144) |
D-9 | 57,009 | AAAAAAAAG | 90 (187) | 10 (187) | 0 (95) | 0 (119) |
D-2 | 57,011 | TT | 90 (187) | 10 (187) | 0 (95) | 0 (119) |
I-5 | 57,591 | AAAGT | 96 (227) | 4 (227) | 0 (148) | 0 (236) |
I-5 | 60,813 | TGTAT | 98 (159) | 2 (159) | 2 (113) | 5 (195) |
D-2 | 65,568 | TT | 91 (202) | 9 (202) | 0 (125) | 2 (234) |
D-1 | 75,933 | T | 95 (152) | 5 (152) | 3 (89) | 3 (161) |
D-1 | 76,184 | A | 99 (213) | 1 (213) | 5 (116) | 1 (166) |
D-1 | 76,524 | T | 100 (216) | 0 (216) | 4 (129) | 0 (106) |
I-3 | 77,677 | TGG | 96 (197) | 4 (197) | 0 (142) | 0 (206) |
D-1 | 78,383 | T | 96 (142) | 4 (142) | 0 (130) | 0 (100) |
I-2 | 80,564 | TT | 100 (242) | 0 (242) | 0 (196) | 1 (173) |
I-4 | 104,486 | CAAA | 99 (287) | 1 (287) | 3 (61) | 2 (400) |
D-4 | 134,497 | AATA | 100 (130) | 0 (130) | 1 (150) | 0 (158) |
All the InDels between 93-11 and PA64S/Nipponbare-G are listed according to the nucleotide order in the 93-11 chloroplast sequence. I or D depict insertion or deletion of a major genotype at a given polymorphic site. The numbers following D or I, joined with hyphens, indicate the InDel length in basepairs. At a given intersubspecific InDel site, the major genotype in 93-11 could be the minor genotype in PA64S or Nipponbare-G or vise versa. Frequency (F) and Minor genotype frequency (MF) are percentages of the major and minor genotype at a given polymorphic locus. The number in the parentheses is the total number of the surveyed sequence traces.