Table III.

The detail information of 50 InDel markers developed in this work for any combinations of japonica (Nipponbare, ZH11, and 9522) and indica (93-11, GLA4, and LTPB)

Marker NameChromosomeBAC AccessionPositionaForward Primer (5′ 3′)Reverse Primer (5′ 3′)Expected PCR Product Size
Nipponbare93-11
R1M71AP00248210,700ATTCCTGGTTCTACATTACTTACGCCTCACTAGAATATCGGA191154
R1M201AP00422218,910TTGGAACAGGGAAGAAGCAGGACATAGTTGTAATGGGTAG263221
R1M301AP00284325,420AAGGGGCCCTAATTTATCTAGTGTTTACTTTGTTCTTGGACTG246197
R1M371AP00345330,500ATAGTTCGCCATCGTCATACACGCCATAGCAAGGAA159212
R1M471AP00344237,470AATAGAATTACTGATGAAACCTTAGCCCGTTACCGCTTATGT159108
R2M102AP0053946,610CCCAGTCTGCTGCCATCTGAATGTATTTCAGTTCCAGTAAG134182
R2M242AP00541411,340GGGCAACAACGGCTCTGAGGGAATAAGGCGATACGG162131
R2M262AP00569615,320GCAGCAAAGTGCGGAGTACAGGTGAATTGCCAATTT143181
R2M372AP00412423,920ACTGTTACCCAAACGCTAACGTGCACCTACTACAGAAA212147
R2M502AP00488830,870CCTGAAGGAAATGATAGCAATAGGTTTTGTATGCTCTTCACTTGTC212254
R3M103AC1057326,370CCGAGTACCATTGCTTTCCTGCCATAGTTACTGCTCTGTT190227
R3M233AC09932316,140TGCTTACAAGGGTCCAATGGAGGTGCCTACCAAGAG149185
R3M303AC09123420,180AGGCTAAGTGAAGAAATAATAAGCTCCGTATTCATTACTGGTTG175199
R3M373AC13393027,130GCATTGAATTGTACTCTTATTATATACGAATCAAAAGGAGACTAAAAT186242
R3M533AC09112333,240ACACTGGCTACGGCAAAGTTTGTTCGGGAATAATGATGC204169
R4M134AL6065978,150TACACGGTAGACATCCAACAATGATTTAACCGTAGATTGG169201
R4M174AL73158511,770AGTGCTCGGTTTTGTTTTCGTCAGATATAATTGATGGATGTA169220
R4M304AL66297918,220GCTTCTCCTGGTTGTATGCAAAATAGGGAGGCAGATAGAC173133
R4M434AL66293824,650CTTGAACCTGAGTGAGTGGCGATGAAAATGATGTCTA160194
R4M504AL60663929,080TTTTGTGAAACTTGACCCTCGCGTCCATGTCTTTATTGTG132165
R5M135AC1324935,820GAGAAAGAGTGGAAGGAGAGTATCGTCAGGAGGGTC175207
R5M205AC13762213,390CTCGCTGTTTACTGACTGGTTTGATGTACTGCCTGCTCT175214
R5M305AC13493020,980CTCAATTTCACCCATCCCCGCTCCGTCTCCAACCTC224178
R5M435AC12136525,960AGCGTGACTTGAGTTCCAATGACTTTCCCACCGTAT10978
R6M146AP0047257,710AAATGTCCATGTGTTTGCTTCCATGTGTGGAATGTGGTTG251217
R6M306AP00592918,640CACAAGCCGTAGCAGAGCTCACGAAAAAGACCCCAAG181147
R6M446AP00538626,080TTAGGAATAAAGGCTGGATATTACCGTTAATAGGTGGAA156122
R7M77AP0057196,350ACCTTCCCTCCCCTTTTGATAACTTGGTCTTCCTGTTTTATTG200133
R7M207AP00434611,680GTTTTGTGCATTCCTTTACTTTATGACATTTTGACCG200266
R7M307AP00518519,550ATGTCGCCTACGAGTTTTCTTCATGTG ACCATTTGTGC187219
R7M377AP00374723,720CAGCCCTAAATCTAAATACCCACGTTGAGACAGGCGAGC173137
R8M108AP0045896,290ACCAAACAAGCCCTAGAATTTGAGAAAGATGGCAGGACGC122174
R8M238AP00550013,820CCTATTCACTCTACCGACATGTTTAGTTCCCATTGCTTT121157
R8M338AP00388121,320CGAAAGAGGAGAGGGGTAGTCGAAAACGAGAAACAAATA205167
R8M468AP00458728,770CAGCAGAGTCCAGAGAAGATGCATAAGATGGCGAGTGA11383
R9M109AP0055924,770CTTTGGATTCAGGGGGAAACTTGAAACGGAGGCAG135178
R9M209AP0058799,290ACTGCTTTGATGGCTTGTGCTCCCCAAACTGAATCC142182
R9M309AP00539714,940CTCACCTACCTAAAACCCAACCCACCCAAATCTGATACTG153185
R9M429AC10875719,450CTATAAGACCAAAACGAAAACTGAAAACCATTGTGTCACTGTA164212
R10M1010AC0985665,150GAATACAACCCCCTAAAAACATGGACCGTTGAGGAGAC170132
R10M1710AC0904869,040TGAACAATAAACCACAGAAGCACCCTTTATTCCCTCCTTTG152183
R10M3010AC02703816,960CCCTAAAAATAGAGCAACCTACCCATAATACTACCAATCAAC152133
R10M4010AC09112219,470GTCCCTAGGCCATCTCTTGGCGAATAGGGGTGGACAG166133
R11M1711AC13758914,370TGAGACGTTTGGGAGCATCGATCAGCAGCAACAGGT183131
R11M2311AC13405319,180AAGGTTGACAAGGACAGAAGTCGCAGGAATGGATAAAA212254
R11M4011AC12578023,540AAGAAAAATATCTATTGAGGAGTGGGAGGACCATAAATGACGG178137
R12M1012AL9541584,300ATCATTTCAGCCTGTGCCAGCTTAATAGGGGGGACG214261
R12M2712AL71392717,370ATTTCATTGCCATCAGTTGTAATCTTCTATCCGTTCA155188
R12M3312AL73188820,080TTGATGATAGTATTTGCTGATGAGATAGTGTCGGCGGTGG208250
R12M4312BX00045726,290CCGCCGAGAAGAAACAAAGCCCAAGAACAGGATTACA193163