Table II.

List of primers used in RT-PCR reactions

Target GeneMIPSPrimer No.Primers 5′ to 3′
BMY1At4g15210CG363ACGCCGGAGAATACAATGF
CG364CAACGGCACAATCTCATGR
BMY7At3g23920CG305GACACCCAGTTCAAAAF
CG306CTCAACTTCTTCCCGACAR
BMY8At4g17090CG307GGAACAAGCGGACCTCATF
CG308TCTCAGCGATCTTGCCTTR
BMY9At4g00490CG382GCTGGCAGGCGTAACACTF
CG383CGGTTTGAGGAGTTGTAGAAGR
IMYAt2g39930CG351CGTCTTGAACCACACAGCF
CG352GCAAAGTCTCCCTCCTCTR
AMYAt1g69830CG345CCAGGGTAGAGGAAACAAF
CG346TCGAAGAAGACCGCTGGTR
PHOS bAt3g29320CG315AAGATGAAGGAAATGAGTGF
CG316CATCTTTTCTGGTCTCGGR
P5CSAt2g39795CG353GGACCAAGGGCAAGTAAGF
CG354AGCCCATCCTCCTCTGTGR
SPSAt5g11110CG321AATGACAATATCTGAGACTCF
CG322ACCACATTCTTTAGCCTCR
RD29A or Cor78At5g52310CG309CTTTGACTCTGTTCTCGGTF
CG310GTTGTCAGTTTCTCCGCCR
Hsp70At3g12580CG258TCAAGCGGATAAGAGTCACTF
CG259CTCGTCCGGGTTAATGCTR
18S rRNAAt3g41768CG359GGAGCGATTTGTCTGGTTF
CG360TGATGACTCGCGCTTACTR
18S rRNA 3′ dideoxyAt3g41768CG361GGAGCGATTTGTCTGGTT-3′F
CG362TGATGACTCGCGCTTACT-3′R