Table I.

Primer sequences

Primer5′ → 3′ sequence
AtMTK-F1GTACCAAAAGCCTATCATATGG
AtMTK-F2GATGATGATGCTAAGGCTGTG
AtMTK-F3AAGCAGAGAAGCAAAGAGATG
AtMTK-R1CTTCTGTGCTCTGTGGTATCG
AtMTK-R3CAAGAACTTCAGCAGAAGAAG
Salk-LbbGCGTTCGAGCAGGGACTC
OsMTK-F1GAATTCGCCGCGGCGGCGGAGCAG
OsMTK-R1GCGGCCGCATCAGTCCCGATC
5′pGEXGGGCTGGCAAGCCACGTTTGGTG
3′pGEXCCGGGAGCTGCATGTGTCAGAGG