Table I.

Oligonucleotides used in this study

Underlines indicate restriction sites.

No.Oligonucleotide NameSequence (5′-3′)
For construction of GST-PpRPOT1 fusion
1    1GST.Fatggatccagatcgtcgtctgattctgtg
2    1GST.Ratgtcgacaatgcactcatgacagcagg
For construction of GST-PpRPOT2 fusion
3    2GST.Fatagatctttgacaccattagattccgca
4    2GST.Ratgtcgacggcattaccatatgcttgac
For construction of PpRPOT1-GFP fusions
5    1-GFP.Ratccatggagaatccaactttagtgt
6    1M2.Fatgtcgacgtagcaatcggtgtgttgga
7    RBCS-RPOT1M1.Fatgtcgacttcatacagaagtgagaaaaatggtagcaatcggtgtgttggaac
8    RBCS-RPOT1M2.Fatgtcgacttcatacagaagtgagaaaaatgtggagggcggcagtaagg
9    1M48I.Fgtgtgagaggcggaatctggagggcggc
10    1M48I.Rgccgccctccagattccgcctctcacac
11    1M1+1.Fatgtcgacatggtagcaatcggtgtgtt
12    1M1-10.Fatgtcgactgaatcgtgcatggtagcaa
For construction of PpRPOT2-GFP fusions
13    2-GFP.Rtaccatggtcaaggaggaagggga
14    2M2.Fatgtcgacccagctgaggtctgctggac
15    RBCS-RPOT2M1.Fatgtcgacttcatacagaagtgagaaaaatgccagctgaggtctgctggacga
16    RBCS-RPOT2M2.Fatgtcgacttcatacagaagtgagaaaaatgtggaggtcggcagcacag
17    2M36I.Fcagtcgccggcatctggaggtcggcag
18    2M36I.Rctgccgacctccagatgccggcgactg
For construction of AtRpoT;2-GFP fusions
19    At2GFP.Fatgtcgacgacatgtgagaaacagagacaaccc
20    At2+1GFP.Fatgtcgacatgtccagtgctcaaacccc
21    At2GFP.Ratccatggcctcttcggctacactcgtgtac
For construction of GUS fusions
22    1M1GUS.Fctcgcgaaaatgaatcgtgcatgttacgtcctgtagaaac
23    1M1.Rgcacgattcattttcgcgag
24    1M2GUS.Fgcggtcgtgtgagaggcggaatgttacgtcctgtagaaac
25    1M2.Rtccgcctctcacacgaccgc
26    2M1-GUS.Fgcagggaattttaggggacaatgttacgtcctgtagaaac
27    2M1.Rtgtcccctaaaattccctgc
28    2M2-GUS.Fccggttatccagtcgccggcatgttacgtcctgtagaaac
29    2M2.Rgccggcgactggataaccgg
30    RBCS-GUS.Fatgtcgacttcatacagaagtgagaaaaatgttacgtcctgtagaaac
31    GUS.Ratgcggccgctcattgtttgcctccctgctgcgg
32    BcaBEST Sequencing Primer M13-20cgacgttgtaaaacgacggccagt