Table I.

Loci with polymorphisms both in the indica-nupt comparison and among sequenced rice pt genomes

–, Absence of nucleotide(s).

LocusCoordinates in the indica Rice Plastomejaponica Plastome131-kb nuptDNA on Chromosome 10O. nivaraindica Plastome
Linking japonica-nupt
    164,174CCAA
    266,410AAGG
    362,529–62,536CTTGGTCTCTTGGTCTAGACCAAGAGACCAAG
    465,623–65,624TTTT
    55,015–5,016CCTTTATCCTTTAT
Linking nivara-nupt
    68,128GAAG
Linking indica-nupt
    717,785–17,78632 nucleotides32 nucleotides
Multiple mutations
    875,989–75,990TTTTT
    977,735–77,736GGTGG
    1078,434–78,440TTTTTTTTTTTTTTTT
    1180,620TTTT
    12134,536–134,545A10A9A11A12