Table I.

Arabidopsis miRNA families

miRNA FamilyLocusSequenceaASRP LibrarybPlant SpeciescTarget Family
Col-0rdr2/dcl3
1miR156a-fUGACAGAAGAGAGUGAGCAC++At, Bn, Gm, Ha, Hv, Lj, Mt, Nt, Os, Pta, Ptr, Sb, Si, So, St, Vv, ZmSBPde
miR156gCGACAGAAGAGAGUGAGCACAAt
miR156hUUGACAGAAGAAAGAGAGCACAt
miR157a-dUUGACAGAAGAUAGAGAGCAC+At, Ptr
2miR158aUCCCAAAUGUAGACAAAGCA+At
bCCCCAAAUGUAGACAAAGCAAt
3miR159aUUUGGAUUGAAGGGAGCUCUA++At, Gm, Hv*, Lj, Mt, Os, Pg*, Ptr, So*, Sb*, Ta*, Vv, ZmMYBdfg
miR159bUUUGGAUUGAAGGGAGCUCUU+At
miR159cUUUGGAUUGAAGGGAGCUCCUAt
miR319a-bUUGGACUGAAGGGAGCUCCCU++At, Bo, Gm, Lt, Os, Ptr, TaTCPg
miR319cUUGGACUGAAGGGAGCUCCUUAt, Os
4miR160a-cUGCCUGGCUCCCUGUAUGCCA++At, Gm, Os, Ptr, Tt, ZmARFde
5miR161.1aUUGAAAGUGACUACAUCGGGG++AtPPRdh
miR161.2aUCAAUGCAUUGAAAGUGACUA++At
6miR162a-bUCGAUAAACCUCUGCAUCCAG++At, Gm, Ll, Mt, Os, Ptr, VvDCL1i
7miR163aUUGAAGAGGACUUGGAACUUCGAU+AtSAMTh
8miR164a-bUGGAGAAGCAGGGCACGUGCA+At, Pb, TaNACdejk
miR164cUGGAGAAGCAGGGCACGUGCG++At
9miR165a-bUCGGACCAGGCUUCAUCCCCC+At, Hc, PtrHD-ZIPIIIlm
miR166a-gUCGGACCAGGCUUCAUUCCCC++At, Gm, Hv, In*, Mt, Os, Ptr, Sb, Zm
10miR167a-bUGAAGCUGCCAGCAUGAUCUA++At, Gm, Os, Pc*, Ptr, ZmARFde
miR167cUUAAGCUGCCAGCAUGAUCUUAt
miR167dUGAAGCUGCCAGCAUGAUCUGG++At, Gm, In, Ptr, So
11miR168a-bUCGCUUGGUGCAGGUCGGGAA++At, Bp, Gm, Ht, Hv, Le, Os, Ptr, Sb, So, St, Vv, ZmAGO1dn
12miR169aCAGCCAAGGAUGACUUGCCGA++At, Gm, Os, PtrHAP2o
miR169b-cCAGCCAAGGAUGACUUGCCGG++At, Gm, Os, Ptr, Zm
miR169d-gUGAGCCAAGGAUGACUUGCCG++At, Ptr
miR169h-nUAGCCAAGGAUGACUUGCCUG++At, Ls, Os, Pb, Ptr, Sb, So, Ta
13miR170aUGAUUGAGCCGUGUCAAUAUC+AtSCRdp
miR171aUGAUUGAGCCGCGCCAAUAUC++At, Os, Ptr, Ta, Zm
miR171.2b-cUUGAGCCGUGCCAAUAUCACG+At, Os, Ptr, Ta, Zm
miR171.1cUGAUUGAGCCGUGCCAAUAUC+At, Gm, Hc, Hv, Os, Ptr, Ta, Zm
14miR172a-bAGAAUCUUGAUGAUGCUGCAU+At, Gm, Le, Os, Ptr, StAP2eqr
miR172c-dAGAAUCUUGAUGAUGCUGCAG+At, Cs
miR172eGGAAUCUUGAUGAUGCUGCAU+At, Os, Ptr
15miR173aUUCGCUUGCAGAGAGAAAUCAC+AtTAS1, TAS2s
16miR390a-bAAGCUCAGGAGGGAUAGCGCC++At, Os, Ptr, St, ZmTAS3s
miR391aUUCGCAGGAGAGAUAGCGCCA+At
17miR393a-bUCCAAAGGGAUCGCAUUGAUCAt, Os, PtrTIR1/F-boxo
bHLHo
18miR394a-bUUUGGCAUUCUGUCCACCUCCAt, Gm, Os, Ptr, RpF-boxo
19miR395a, d-eCUGAAGUGUUUGGGGGAACUCAt, Gm, Os, Ptr, TaATPSo, ASTs
miR395b-c, fCUGAAGUGUUUGGGGGGACUCAt
20miR396aUUCCACAGCUUUCUUGAACUG+At, Bv, Gm, Mc, Os, Ptr, So, St, ZmGRFo
miR396bUUCCACAGCUUUCUUGAACUUAt, Bn, Gm, Mc, Os, Ptr, St
21miR397aUCAUUGAGUGCAGCGUUGAUG+At, Hv, Os, PtrLaccaseo
miR397bUCAUUGAGUGCAUCGUUGAUGAt
22miR398aUGUGUUCUCAGGUCACCCCUUAt, Cs, Gm, Lj, Mt, Os, PtrCSDo
miR398b-cUGUGUUCUCAGGUCACCCCUG+At, Gm, Ha, Ls, Mt, Nb, Os, Zm*CytC oxidaseo
23miR399aUGCCAAAGGAGAUUUGCCCUGAtE2-UBCs
miR399b, cUGCCAAAGGAGAGUUGCCCUG+At, Mt, Os, Ptr, Sb
miR399dUGCCAAAGGAGAUUUGCCCCGAt, Os
miR399eUGCCAAAGGAGAUUUGCCUCGAt
miR399fUGCCAAAGGAGAUUUGCCCGGAt, Os
24miR403aaUUAGAUUCACGCACAAACUCG+At, PtrAGO2s
25miR447a-bUUGGGGACGAGAUGUUUUGUUG+At2PGKs
miR447cUUGGGGACGACAUCUUUUGUUG
  • a miRNAs are grouped by related families, with differences among families marked in bold.

  • b Col-0 libraries included Col-0 and jaw-d sequences.

  • c Presence of miRNA in genomic sequence is indicated in regular text, EST sequences are in bold, and sequences with 1 to 2 base changes from the Arabidopsis sequence are indicated by an asterisk. See Supplemental Table IV for plant species abbreviations.

  • d Vazquez et al. (2004).

  • e Kasschau et al. (2003).

  • f Achard et al. (2004).

  • g Palatnik et al. (2003).

  • h Allen et al. (2004).

  • i Xie et al. (2003).

  • j Mallory et al. (2004a).

  • k Laufs et al. (2004).

  • l Tang et al. (2003).

  • m Emery et al. (2003).

  • n Vaucheret et al. (2004).

  • o Jones-Rhoades and Bartel (2004).

  • p Llave et al. (2002b).

  • q Aukerman and Sakai (2003).

  • r Chen (2004).

  • s Allen et al. (2005).