Table I.

Primers used in this study

Primer NameSequenceStrategy
tlg-1UTAYAAYGGNTGYCCNTTYAC(YNGCPFT)aDegenerate PCR
tlg-2UATHTGGCCNGCNATGTTYAC (IWPAMFT)aDegenerate PCR
tlg-474 L RACEGCAGTTGGGGGAGTTTTGTTGGTCA5′ RACE
tlg-172 L RACETGCATCCACCATCAAGACACGAGTT5′ RACE
tlg-ATGATGAAGTTCACCACTGCTGCCTCTCORF sequence
tlg1-TAALTTAAGCAGGAGGACAGAATGORF sequence
tlg GW-238 LTGAAAAAGGAGAAGAGGAGCAGGAGGenome walking
tlg GW-316 LAAAGGAAGAGGAGTGGGCGGAAAGGGenome walking
tlg-391 LCCTGGGGTGCCTAATGAGTGGenome walking
tlg-259 LCGTCGTATGCGTAGGCGTAGGenome walking
tlg-302UCTTTGTCGACGGATACAATCGenome walking
tlg-541UCTCAGAAGAACCCACGAACTGenome walking
tlg-001UATTTGGCCTGCGATGTTCACProbe construction
tlg-391 LCCTGGGGTGCCTAATGAGTGProbe construction
tlg-NtGCTAGGACTTTCACGGTCTATAACGVector construction
tlg-Nt-BamHICGCGGATCCGGCTAGGACTTTCACGGTCTATAACGVector construction
tlg1-TAAL-NotIAAGGAAAAAAGCGGCCGCTTAAGCAGGAGGACAGAATGVector construction
  • a Amino acid sequence from which the degenerate primer was designed.