Table I.

Primers used in this study

Primer NameSequence (5′–3′)
Cloning primers
    YSL1 cDNA forwardCAGTCTCCATGGAAATAGAGCAAAGAAGG
    YSL1 cDNA reverseAAAACAGAGCATGAATCATCCGGATG
AATATTTGAAGCTATACCAAGCATACAATCA
ACTCCAAGCTTCGAGCGGCCGCCTTGGAAAA
    YSL3 cDNA forwardAAATGAGGAGTATGATGATGGAGAGAGAGGG
AAGCCGACAACCTTGATTGGAGACTTGACCA
ATGGCGAAGAAGTCCAAAGCTTCGAGCGGCC
    YSL3 cDNA reverseGCTTAACTCGAATATTTACTCGGCATGAAGCC
    YSL4 cDNA forwardTTGGAGTTATGGAGACGGAGATTCCTAGG
    YSL4 cDNA reverseTTCGTTGGTCAACCTTGTCTGTTTGAC
    YSL6 cDNA forwardCTCAACATTTTCTCTTCCGCCATAACCAA
    YSL6 cDNA reverseTCCTTTTGTATGACTCACAGTTGCGGTTG
    YSL8 cDNA forwardCTTGTTCACCATCTCTCTTATTTCGCAGAT
    YSL8 cDNA reverseCTTCTTCAACAGATCCATCTCATTGAGCTT
RT-PCR primers
    YSL1 RT forwardACAAGGAGATGCACAGGCCAAGAAA
    YSL1 RT reverseTCACAGCCGCGATGACAAAAAGAC
    YSL3 RT forwardATTGGCCAGGAAACAAGTGTTTGGGT
    YSL3 RT reverseGACAAGTCCCGCGACTACACCATTT
    IRT1 RT forwardGAGTCATTGCCATGGTCTTGGA
    IRT1 RT reverseGTATACTCAGCCTGGAGGATACAACCG
    18s forwardCGGCTACCACATCCAAGGAA
    18s reverseGCTGGAATTACCGCGGCT