Table II.

Result from the siRNA Scan search with Arabidopsis BTI1 coding sequence as a trigger

TC numbers in bold are the ones used for quantitative RT-PCR.

Off-Target IDIdentical (I) or Reverse Complementary (RC) SequenceBLAST Search
NP167859I, AGCCTGTTCATAAGGTTCTCGGArabidopsis reticulon family protein (RTNLB6) (At3g61560).
NP302761I, AGAAGAAGAAGACTAAGAAGCI, AGCCTGTTCATAAGGTTCTCGGContains similarity to DnaJ gene YM8520.10 gb|825566 from Saccharomyces cerevisiae cosmid gb|Z49705. ESTs gb|Z47720 and gb|Z29879 come from this gene.
TC251496RC, TGATTCTTCTTCGTCTTCTTCGB|AAM51226 Unknown protein {Arabidopsis}; similar to UP|Q6Z702 (Q6Z702) putative 3-isopropylmalate dehydratase large subunit.
TC251703I, CCTGTTCATAAGGTTCTCGGCG; I, TGGTCTAATGCCACTATGTTCATT;I, CCAAAGATTCCTGAAGTTCATATCCCTGAAGAACCT;I, TTCTTGACATTGGCATACATAGCTCTGB|AAP47461.1|32331867|AY164887 RTNLB2 {Arabidopsis}, complete. Recently identified as BTI2.
TC255665I, TCTTCGTCTTCTTCATCTTCTGB|AAD31078.1|4850408|F3F19 Contains PF|00097 zinc finger (C3HC4) ring finger motif. {Arabidopsis}, complete.
TC256637RC, TTCTTCTTCGTCTTCTTCATCPIR|B96716 Probable Ser/Thr kinase F23O10.20 [imported]—Arabidopsis.
TC258543I, AGCCTGTTCATAAGGTTCTCGGGB|AAP47457.1|32331859|AY164883 RTNLB6 {Arabidopsis}, partial (90%).
TC262843I, CTTCTTCGTCTTCTTCATCTTCTUP|O49467 (O49467) Hypothetical protein F24J7.50 (hypothetical protein AT4g19490).
TC263798RC, TTCTTCTTCGTCTTCTTCATCGB|AAO50470 Unknown protein {Arabidopsis}.
TC265975I, AGAAGAAGAAGACTAAGAAGCUP|080799 (080799) T8F5.5 protein; weakly similar to PIR|S64314 probable membrane protein YGR023w—yeast (S. cerevisiae).
TC269146I, CTTCTTCGTCTTCTTCATCTTCTUP|O49467 (O49467) Hypothetical protein F24J7.50 (hypothetical protein AT4g19490).
TC275407RC, TTCTTCTTCGTCTTCTTCATCUP|Q8VYC1 (Q8VYC1) Putative Ser/Thr kinase.
TC275528I, GAGAAGAAGAAGACTAAGAAGUP|Q9FJR9 (Q9FJR9) Similarity to maturase-related protein, complete.
TC275625RC, TTCTTCTTCGTCTTCTTCATCTTCTGB|AAM51439 Unknown protein {Arabidopsis}; weakly similar to UP|081812(081812) auxilin-like protein, partial (13%).