Table III.

Result from the siRNA Scan search for potential off-targets with the cloned sequences of N. benthamiana TC381 and TC1146 (Supplemental Fig. S1) as trigger sequences

TC numbers in bold are the ones used for quantitative RT-PCR.

Target IDAnnotation of the TargetPotential Off-TargetIdentical (I) or Reverse Complementary (RC) SequenceAnnotation of the Potential Off-Target
TC381Similar to TIGR_Osa1|9630.m01295 U2 snRNAP protein, Arabidopsis, partial 79%CK286172RC, GGGTGTATTCTGGCCCGGGCC TGRC, TATCTTGTATAGTAGTTATTAGTATAGTSimilar to UP|O93419 (O93419) collagen XVIII precursor, partial (1%).
CK288691RC, TATCTTGTATAGTAGTTATTAGTATAGTAnnotation not available.
CK289650I, TTCGCGGTCCCGGGCTTCGTGSimilar to TIGR_Osa1|9631.m00421 CYFIP2, partial (9%).
TC10748I, TATCTTGTATAGTAGTTATTA GTATASimilar to TIGR_Ath1|At5g13210.1 68418.m01516 expressed protein, partial (17%).
TC7796I, TATCTTGTATAGTAGTTATTA TGTATAGWeakly similar to UP|Q75NB3 (Q75NB3) Cys proteinase, partial (34%).
TC1146Similar to UP|Q8H9C6 (Q8H9C6) pyruvate decarboxylase (fragment), partial (33%)CK282591RC, ATCGCTTTGCGAACCCGACTAGSimilar to UP|Q6Z3U3 (Q6Z3U3) VP1/ABI3 family regulatory protein-like, partial (5%).
CK287535RC, ATCGCTTTGCGAACCCGACTAGSimilar to TIGR_Ath1|At5g65980.1 68418.m08307 auxin efflux carrier family protein contains auxin efflux carrier domain, Pfam:PF03547, partial (14%).
CK292351RC, TTTGTTCTCGGGCCTTTACCAGSimilar to UP|CP22_HORVU (P55748) Ser carboxypeptidase II-2 precursor (CP-MII.2) (fragment), partial (30%).
CK296810RC, ATCGCTTTGCGAACCCGACTAGSimilar to TIGR_Ath1|At5g65980.1 68418.m08307 auxin efflux carrier family protein contains auxin efflux carrier domain, Pfam:PF03547, partial (11%).
TC8666RC, ATCGCTTTGCGAACCCGACTAGSimilar to TIGR_Ath1|At2g17500.1 68415.m02022 auxin efflux carrier family protein contains auxin efflux carrier domain, Pfam:PF03547, partial (41%).