Table V.

Oligonucleotide primers used in this study

Primer NameSequence (5′ to 3′)
BS-forwardCGATTTTGTAACACGTACGTACAACACG
BS-reverseCCCGAGAATTACATGGTAGTAATACAGAAGG
BS-forward1GAATTCATGTGGAGGTTAAAGATAGCCGAAG
BS-reverse1GAATTCAGACGAGATTATGGCGATTATTAG
BS-forward2GCCGTCAACTACCTCGCCGCCATACAAGC
BS-reverse2CGGGTCTTCAACCCAGCACGCCAACATAC
GT33-F1CCGCTCGAGATGTCTAATAATGAAAACAATGC
GT33-R1CCGCTCGAGTTAAGAAGACGAAAGCCACTC
GT33-F4ATGTCTAATAATGAAAACAATGCAACTCAAGTAATAG
GT33-R4ACAGAAGAAGCTATCCGACTATCCCTCC
GT33-SEQ3CAGCAGCGTCCGCCTCGTTTGCTTGTTAC
GT33-SEQ4GCACGACCATGCCTTGTCCCGAGATTTTC
GT33-SEQ5ATGTGAATTATTGTCACCATATGC
GT33-SEQ6GCATATGGTGACAATAATTCACATATGGGCCTTCACCCTTTAG
SQ4A(A/G)(A/G)TA(I/C)(G/C)(A/T)(C/T)TC(I/C)CCCCA(I/C)CC (I/C)CCI
SQ5GA(T/C)GGIGGITGGGGI(T/C)TICA
SQ8(A/T)(C/G)ITT(T/C)(C/T)TICCIATGCA(T/C)CCIGCIAA
SQ9TC(T/C)TGIGCICCIGCIGG(T/C)TCCCAIGC
SQ10GATGGACCCTGAGAGACTCTATGAC
SQ11CAGACCGTTGAATGGCCAGCGAGTAAGAAGAGG
SQ12GGTGTAATCGGACCAACGAACCTC