Table I.

Primers used for qRT-PCR analysis of OsYUCCA gene expression in rice organs

GeneForward Primer Sequence (5′ → 3′)Reverse Primer Sequence (5′ → 3′)
OsYUCCA1tcatcggacgccctcaacgtcgcggcagagcaagattatcagtc
OsYUCCA2gtccaaagggaggagtcgtccaggcatgatgtttacacccggcctt
OsYUCCA3gtgagaacgggctctactcggtcggcttatgcatgaccgatgaacacg
OsYUCCA4gcagaatggcctgtacgctgttggcagaccagcacatgacgtgtctac
OsYUCCA5acctcctacgacgccgccatgatcctcccaacacagcgacgacagaac
OsYUCCA6ccattcccagatggttggaaggcatgttgcgcctcaagatatttg
OsYUCCA7cactgctgtgtcctacaatatcacggaggtgcatctccgtcatcttc