Table II.

Gene-specific QPCR primers, with PCR product sizes in base pairs and optimal acquisition temperatures for the genes analyzed

GeneForward PrimerReverse PrimerPCR SizeAcquisition Temperature
bp°C
GAPDHGTGAGGCTGGTGCTGATTACGTGGTGCAGCTAGCATTTGAGAC19880
HSP70CGACCAGGGCAACCGCACCACACGGTGTTGATGGGGTTCATG10883
α-TubulinAGTGTCCTGTCCACCCACTCAGCATGAAGTGGATCCTTGG24880
CyclophilinCCTGTCGTGTCGTCGGTCTAAAACGCAGATCCAGCAGCCTAAAG12279
HvCslF3CTTGTTGCCGGTTGCCTTTACATCAATTGGCTAAAATGGAAGAAAACTA9072
HvCslF4CCGTCGGGCTCGTGTATGTCTTGCAGTGACTCTGGCTGTACTTG14481
HvCslF6TGGGCATTCACCTTCGTCATTGTCCGGGCAAACTCATCAA15782
HvCslF7CCCTGCTCTTGCTTGTCGTAGTAGCCAAGCAATTGCATTT12276
HvCslF8GCGTGGATTCTGGTGCTGATCTACCACCAATGCGATCAAAATAAAC11980
HvCslF9CTGCCACCGCGTCCGTGTAAGGTTTTGCAGCATTACTTGA10180
HvCslF10GGCTATTGTTCAACCTGTGGATTATGGCCAAGAAAGCAATGGGTAGT12077