Table IV.

List of primers used in RT-PCR and mutant analysis

Gene (At Locus)Primers, Forward/Reverse
GAPC-1 (At3g04120)TCTCATATGCTGACAAGAAGAT
CACTCCCTATCATTCGAGATCTGCTTC
GAPC-2 (At1g13440)GAGTACATGACCTACATG
TCAACCACACACAAACTCGAGCCGGTG
NP-GAPDH (At2g24270)AGACATATGGCCGGGACTGGATTGTTT
ACCCTCGAGCTAACCCATAGAGTAAGAAGGT
RBCS-1 (At1g67090)AAAGGTACCATGGCTTCCTCTATGCTC
AAACATATGAAGGTCAGGAGGTAAGA
CAT1 (At1g20630)GATAAGCTACTCCAGACCCGGA
CTGAGACCAGTAAGAGATCCA
CAT2 (At4g35090)GATAAGCTGCTTCAAACCCGTG
CTGAGACCAGTAAGAGATCCA
CAT3 (At1g20620)ACGACAAGCTGCTCCAGTGTA
CTGAGACCAGTAAGAGATCCA
PK (At3g25960)ATGCATTCCAGTCATCTCC
TGGTGTCTCCTTTCTTCAC
PK (At3g25960)ATGGAGATGTTACTTGGTG
TCCTTGTATCTTGTAATCAAT
RCA (At2g39730)ATGGCCGCCGCAGTTTCCAC
TAGGAGCTTGGAAGACAGAG
PDC-2 (At5g54960)AGATCGGATCTATCGACGCG
GGTTTGGTTCGGCGATTAGG
AOX (At5g64210)ATTTTTTCAGAGACGATA
GCGAATGTCAGAAGCAAA
PEROX (At3g06050)ATCTTCAAGGGGAAGAAA
GCCGACCATCTCTCAGAC
SDH (At3g27380)AAACATATGGCGGAGGCGGAAACAAAA
AAACTCGAGACGCTGAAGTTGCTTGAT