Table V.

Oligonucleotides used in this study

Oligonucleotide NameDNA Sequence 5′–3′
AcGO1ACGGGATTTTCCCATCCTAC
GO 3′UTR FGATACTCAGCTCGTGCATGGAT
GO 3′UTR RCAAATACAGAGAGATCACCATGTGC
GOA1GCCGTCAATGAAACCAAACCAGAGACC
GOA2GTCCTTGCAGCGGCGTACCATCTGG
GOB1CTGAATCAGCAGCCTGCCCATG
GOB2TCGACGAAGCTCCATATGTACTGC
GOC1AAGTCGACCGCACCCTGAGCTG
GOC2AGACGTCAAGTGGTTGCAGACCA
GO IN2 FAACTTCAAGCGTCGAGGAGGTTGC
GO IN2 RACCTTCGAAGTTCTTGAGCGTCAG
GO IN3 FCTGACGCTCAAGAACTTCGAAGGTC
GO IN3 RTGGTCTGCAACCACTTGACGTC
GO OUT FACACCTGACGCTCAAGAACTTCG
GO OUT RCACTGGAATCGGGGAGCTG
GO OUT R2GGACATCTGCAGACCATTATGG
GO OUT R3TGAAGGCAGGGTAACCA
GOP1CGCTCGCTCTTGGCGCTTCTG
GOP2CATGTGCAGACAAGGCAGCTCTGG
ZGO1CACACCTGACGCTCAAGAACT
ZGO2GTGGTTCGACACGATGATCC