Table IV.

Main characteristics of genes and primer sequences used in this work

id, Identity; hom, homology; aa, amino acid; NCBI, National Center for Biotechnology Information.

Name of Sunflower GenePutative FunctionGenBank of CGP EST Accession No.Amplification Product SizePrimer SequencesIdentity Percentage of EST Sequences with Other Plants (Plant, Accession No.)Presence of Conserved Domain (Search against NCBI Conserved Domain Database)
HaNADPHoxNADPHox>QH_CA_Contig929116Forward: AGGGTCGTTTGACTGGTTC79% id bp (Nicotiana benthamiana, AB079499)Oxidoreductase FAD-binding domain
Reverse: ACCGAGCATCACCTTCTTC
HaPOXPeroxidase l>QH_CA_Contig2935101Forward: CCTCCGTTATTCGCCTTC71% hom aa (Arabidopsis, NP_172906)Plant peroxidase superfamily domain
Reverse: ATTGGCTGCTGACTCCTTC
HaAO1Amine oxidase>QHL17I14.yg.ab1108Forward: CGACTGTATCATCATCGAGTT80% id aa (Solanum lycopersicum, CAI39243)Cu-amine-oxide superfamily domain: copper amine oxidase, catalytic domain
Reverse: GCGTTACAAACTGGCAAATC
HaAO2Amine oxidase>QH_CA_Contig3110181Forward: CGTCCTTTGGTATGTGTTTG79% id bp (Glycine max, AF089851)No putative domain
Reverse: GGTTTCTTTATGCTCGGTGT
HaSer/ThrKSer/Thr protein kinase>QHB16I20.yg.ab1195Forward: CAAGGGAGGTGACTTTGG86% id aa (Arabidopsis, BAF01492)S_tkc superfamily domain: Ser/Thr protein kinases, catalytic domain
Reverse: ATGTTGGCATACGGCTCT
HaMAPK6Mitogen-activated protein kinase>QH_CA_Contig1463182Forward: CAAGCAACCCTCTACTGAAC87% id aa (Solanum tuberosum, BAB93530)S_tkc superfamily domain
Reverse: GCAACCCACAGACCATAC
HaCaMCalmodulin>QH_CA_Contig1037168Forward: GAGTTCCTTGGTGGTGATG94% id aa (Arabidopsis, NP_850860)EF-hand, calcium binding motif
Reverse: GACCTGTGTTGTCGTTTCAG
HaPTPProtein Tyr phosphatase>QH_CA_Contig640107Forward: TTTCAAGTGGAGGTTGTGGT59% hom aa (Arabidopsis, CAB62119)No putative domain
Reverse: GAGGGAGGATTTGGTGTTG
Haβ-tubulinβ-TubulinQH_CA_Contig4019132Forward: GGCGTCTACCTTCATTGGT95% hom aa (Arabidopsis, NP_568960)β-Tubulin domain
Reverse: TCCATCTCATCCATTCCTTC