Table III.

Oligonucleotide primers for cloning and expression analysis

Name+/−aSequence (5′ to 3′)Purpose
ms248+GATGATTTTGGNGAYTTTRCWCCHCT cloning
ms252AATNCMRSCWGGTCCCAT
SMART+TACGGCTGCGAGAAGACGACAGAAGGGHCT2 RACE
5′ primer+TACGGCTGCGAGAAGACGACAGAA
ms492CCCTTATCTTTTGTGCTACATAG
ms493CCTAAAGGCTTTAATGTGATTTCTC
ms521+GATGTTAACTTAAACCATAATACCHCT2 cloning
ms490GTTTGATAAATGCAAAGAACTAAACTTT
ms407+GCGCGCCATATGATCATAAACGTGAGAGATHCT1 expression
ms408CGCGCGCTCGAGTTATCAGATATCATACAAGAATTCC
ms522+GCCATGGTTACCATTAAAAATTCTTACHCT2 expression
ms523GCTCGAGTCATATATCCTCATAGAAGTAC
ms381+CGCGAATGGACAACGAGTATTHCT1 q-rtPCR
ms382TACCAAGATTCGGGCACTTGA
ms595+ACACCCTCGAAAGTACCACGTTHCT2 q-rtPCR
ms596TCTTCACTTGTGTCTTTTCTTCCTATAATG
ms597+GACATGGACCAAAATACTCGTGATAEIF4A q-rtPCRb
ms598CAGTTGTTATGAGCACTCGTGAAGA
  • a Orientation: +, sense; −, antisense.

  • b Based on GenBank accession BB919542.