Table I.

Transcription factors that were suppressed in ppi2-1

Tag Sequence (5′ to 3′)aTag CountArabidopsis Genome Initiative CodeProtein
Wild Typeppi2-1
AAAGGAAGGTTCGTCAAGAGAT352AT1G68520.1COL6 (CONSTANS-LIKE6)
AACAGTATGACATCAACGGTGA266AT5G44260.1Zinc finger (CCCH-type) family protein
GAGATATTGGTTTCTTCTATTA156AT2G36990.1SIG6 (RNA POLYMERASE SIGMA-70 FACTOR)
GTGGTATCTTTAGTGGGTTCGG133AT5G24930.1COL4 (CONSTANS-LIKE4)
TTATATCTCACTTTACAAATTT91AT1G25440.1COL16 (CONSTANS-LIKE16)
CGATGAGAAGACTATGATAAGT80AT1G02340.1HFR1 (LONG HYPOCOTYL IN FAR-RED)
GTTGACATCAATCAATCATCAA83AT2G18300.2Basic helix-loop-helix (bHLH) family protein
TGAATCGGCAGCAGAACTCGAG81AT4G27410.3RD26 (RESPONSIVE TO DESICCATION26)
TGACTAATAAGGAGACCCTTTT70AT2G20570.1GLK1 (GOLDEN2-LIKE1)
AATGATGATGAGGTTACTTTGA70AT2G47890.1COL13 (CONSTANS-LIKE13)
ATTAAGTGGCTTGAAATGTAAA62AT1G19350.1BES1 (BRI1-EMS-SUPPRESSOR1)
TTTATGCTTCAGCAGCACACGC60AT5G57660.1COL5 (CONSTANS-LIKE5)
TAACTGTGAATCTGAAGATTCA50AT1G68190.1Zinc finger (B-box-type) family protein
GTCTGATACAGTTTGATCCAGT50AT2G02080.1ATIDD4 (ARABIDOPSIS THALIANA INDETERMINATE DOMAIN4)
CTAAGTATCATTGAAGAGGAGC51AT5G46690.1BHLH071 (BETA HLH PROTEIN71)
CATACTGGAGTCAAAGTCAATG51AT5G60850.1OBP4 (OBF-BINDING PROTEIN4)
  • a Tag represented as a 22-bp sequence excluding the NlaIII site (CATG).